A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CAPÍTULO 1 CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO Profa.Ivana BM Cruz, UFSM - 2011.

Apresentações semelhantes


Apresentação em tema: "CAPÍTULO 1 CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO Profa.Ivana BM Cruz, UFSM - 2011."— Transcrição da apresentação:

1 CAPÍTULO 1 CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO Profa.Ivana BM Cruz, UFSM

2 Padrão de Organização dos Seres Vivos Auto-criação (autopoiése) Reprodução Manutenção da constância do ambiente interno (homeostase) e do reparo

3 AUTO-CRIAÇÃO

4 REPRODUÇÃO

5 HOMEOSTASE

6 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Carboidratos Glicose UNIDADE Alimentos -Produção de energia: glicose -Armazenamento de energia: Glicose- Sangue Glicogênio – Músculos Fígado Fonte carboidratos (glicose): -Dieta -Produzida pelo organismo

7 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Lipídios Principais moléculas Ácidos graxos -Triglicerídeos -Colesterol Moléculas mais heterogêneas Participam: - Membrana Plasmática - A partir do colesterol são sintetizados todos os hormônios esteróides do corpo como o estrogênio, testosterona, vitamina D, etc.

8 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Proteínas Unidade fudamental: Aminoácidos Cadeia de aminoácidos Alimentos Molécula fundamental na estrutura celular do ser vivo

9 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Proteínas 20 AMINOÁCIDOS AMINOÁCIDOS ESSENCIAIS: não sintetizamos arginina, fenilalanina, isoleucina, leucina, lisina, metionina, serina, treonina, triptofano, histidina e valina AMINOÁCIDOS NÃO-ESSENCIAIS alanina, asparagina, cisteína, glicina, glutamina, prolina, tirosina, ácido aspártico, ácido glutâmico

10 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS Ácidos Nucleícos: DNA & RNAs

11 ORGANIZAÇÃO DOS SERES VIVOS MULTICELULARES

12 NÍVEIS DE ORGNIZAÇÃO DOS SERES VIVOS

13 CÉLULAS E TECIDOS

14 Membrana Celular

15 Membrana Celular: funções - Delimitação (isolamento físico) da célula em relação ao ambiente que a rodeia; -Regulação das trocas químicas ou físicas entre o interior da célula e o ambiente externos; -Comunicação entre as células e o seu meio ambiente; -Suporte estrutural para que as células formem os tecidos corporais -Delimitação de ambientes específicos intracelulares que possuem funções diferenciadas (organelas).

16 Membrana Celular Fonte: Silverthorn, 2002

17 Membrana Celular

18 Membrana celular: estrutura

19 Membrana celular: proteínas

20

21

22

23

24

25

26

27 Movimento através da membrana

28 Membrana: comunicação célula- célula Fonte: Silverthorn, Existem dois tipos de sinais: químicos ou elétricos -Existem três processos de comunicação: (1) transferência citoplasmática de sinais junções comunicantes químicos/elétricos via junções comunicantes (2) comunicação local de substâncias que se difundem através do líquido extracelular se difundem através do líquido extracelular (3) comunicação a longa distância: hormônios

29 Membrana: comunicação célula- célula

30

31

32

33

34 CITOSOL E ORGANELAS

35 PRINCIPAIS FUNÇÕES DO CITOESQUELETO Determina a forma das células Estabiliza a posição das organelas dentro do citoplasma Auxilia no transporte de moléculas para dentro e para fora da célula Auxilia na manutenção da célula em um local do tecido Permite o movimento de algumas células através do corpo

36 CITOSOL E ORGANELAS

37

38

39

40

41

42 MATRIZ EXTRACELULAR Material sintetizado que e secretado pelas células de um tecido A quantidade de matriz extracelular As moléculas que compõe a matriz extracelular Serve como sustentação do tecido e atua na manutenção da homeostase corporal Altamente variáveis e dependente do tipo de tecido

43 CICLO CELULAR

44 SENESCÊNCIA CELULAR 123n123n LIMITE DE HAYFLICK + 50 DIVISÕES

45 CICLO CELULAR MITOSE G2G1 S n=50

46 ENVELHECIMENTO CELULAR G2G1 MITOSE S Modificações Estruturais e funcionais n ~ 50 -Cessa a proliferação - Célula cresce

47 Revisando… Proteção aos genes que estão nos cromossomos

48 Telômero possui uma simples molécula de DNA Resto do cromossomo é dupla fita (TTAGGG) n Estrutura telomérica Cromossomo

49 ENCURTAMENTO TELOMÉRICO

50 Processos Fundamentais da Diferenciação Celular

51 Mitose Divisão Celular Prófase Metáfase Anáfase Telófase

52 Interações Bioquímicas Moléculas bioquímicas modulam: regulação diferencial dos genes: Genes funcionam conforme: - células e estágio do desenvolvimento

53 Célula Núcleo Como ocorre o desenvolvimento corporal e a manutenção da homeostase se todas as células contém o mesmo DNA?

54 DOGMA GENE-PROTEÍNA/RNA 3TAAGCAATCTCTGGTAAGCTA5 5ATTCGTTAGAGACCATTGGAT3 Núcleo 5ATTCGTTAGAGACCATTGGAT3 DNA htRNA 5ATTCGTTACCATTGGAT3 Proteínas Célula Sliplicing mRNA

55 ESTRUTURA DO GENE EUCARIÓTICO

56 Região Promotora Estradiol Modulação da Expressão do gene Testosterona Inibição/ Estimulação

57 REGULAÇÃO DA EXPRESSÃO GÊNICA Região Promotora Modulação da Expressão do gene Inibição/ Estimulação Resveratrol DIETA BENEFÍCIO A SAÚDE

58 Regulação Gênica Muitos processos biológicos ocorrem em todas as células portanto a síntese de muitas proteínas é igual PROTEÍNAS Algumas PROTEÍNAS são abundantes em tipos Especializados de células apesar dos seus TODAS AS CÉLULAS Genes estarem em TODAS AS CÉLULAS

59 Regulação Gênica Estudos sugerem que uma célula eucariótica Expressa aproximadamente mil genes dos 30 mil genes que possui.

60 Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

61 Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

62 Movimento Celular -Para a formação dos tecidos e órgãos -Muitas células precisam se mover dentro do embrião -Este processo denomina-se: -Movimento Celular ou Migração Celular -Movimento celular é gerado por elementos contráteis do citoesqueleto -Principais proteínas associadas ao movimento celular: integrinas e fibronectinas

63 Direção da migração Contato focal Filopódia Integrinas Parece que a migração celular é mediada por proteínas que são agrupadas Família Abelson de tirosina quinases- Abn Family.

64 Processo pelo qual as células ficam aderidas em um determinado local do corpo. Mediado por moléculas conhecidas como: CAM= moléculas células-adesivas (Cell Adhesive Molecules) Ex. Caderinas Adesão Celular

65 Caderinas conectam uma célula na outra Auxiliando na adesão a matriz extracelular

66 Morte Celular Programada- Apotose Suícidio de determinadas linhagens celulares ao longo da embriogênese, ou de algumas células ao longo da vida

67 Morte Celular Programada- Apotose Exemplo: formação dos dedos

68 BIOLOGIA CELULAR E O CÂNCER

69 ESCAPE DA SENESCÊNCIA REPLICATIVA CELULAR: CÂNCER Causado pelo crescimento descontrolado de células que também têm a capacidade de invadir outros tecidos e formar tumores secundários (metástases)

70 O CÂNCER É UMA DOENÇA GENÉTICA CAUSADO POR ACÚMULO DE MUTAÇÕES Ocorrem mutações no DNA Ativam genes que estavam silenciados Proto-oncogenes Inativam genes que estavam ativos Genes de supressão tumoral

71 Célula normal 1 a Mutação 2 a Mutação 3 a Mutação Célula Maligna (Câncer)

72 PRINCIPAIS ALTERAÇÕES MORFO-FUNCIONAIS DA CÉLULA CANCEROSA

73 (1) DIVISÃO CELULAR Escape da senescência celular G2 G1 S Número Indefinido de Mitoses MITOSE NEOPLASIA IMORTALIZAÇÃO

74 PRINCIPAL CAUSA DA IMORTALIZAÇÃO RE-ATIVAÇÃO DA ENZIMA TELOMERASE OS TELÔMEROS DA CÉLULA VOLTAM A SER PRODUZIDOS CÉLULA SE REPLICA INDEFINIDAMENTE

75 Linhagem celular Imortal de Henrietta Lacks Mulher jovem com câncer cervical (Adenocarcinoma) Morreu em 1951 Células continuam a ser produzidas e utilizadas por laboratórios no mundo todo CÉLULAS HeLA Utilizadas para estudos in vitro sobre o câncer Imortalização

76 (2) ALTERAÇÕES NAS INTERAÇÕES BIOQUÍMICAS Citoesqueleto desorganizado: perda da forma celular original Menor quantidade de organelas Menor tamanho celular Perda da função celular Núcleo fica proporcionalmente maior em relação a célula

77 (2) Exemplo: câncer de colo do útero Útero Cervix saudável Cervix com carcinoma Esfregaço celular (Exame Papanicolau) Célula saudável

78 (3) MOVIMENTO E ADESÃO CELULAR

79 (3) MOVIMENTO E ADESÃO CELULAR Consequência principal: METÁSTASES

80 (3) MOVIMENTO E ADESÃO CELULAR

81 (4) APOPTOSE Câncer – resistência a apoptose células não desencadeiam a sua morte Esta alteração está relacionada: - com o inicio da carcinogênese - com resistência de células cancerosas a quimioterapia e a radioterapia Mecanismos de resistência: - inibição de proteínas pró-apoptóticas Ex. p53 - expressão de proteínas pró-oncogênicas Ex. survivinas

82 CONSIDERAÇÕES FINAIS O padrão de auto-organização dos seres vivos, em especial dos organismos multicelulares, Envolve padrões cito-morfológicos e fisiológicos Que garantem o seu desenvolvimento, processos de regeneração/cicatrização, controle homeostático e reprodução. Para tanto existem 05 processos fundamentais

83 REFERÊNCIAS – BIBLIOGRÁFICAS E DE FIGURAS JUNQUEIRA LC & CARNEIRO J. Histologia Básica. Guanabara-Koogan, Rio de Janeiro, 2004; 2008 KERR JB. Atlas de Histologia Funcional. Artes Médicas, Porto Alegre, GARTNER Color Atlas Histology. Williams & Wilkins, Baltimore, KIERSZENBAUM AL. Histologia e biologia celular: uma introdução a patologia. Elsevier, Rio de Janeiro COCHARD LR. Atlas de embriologia humana de Netter. Artmed, Porto Alegre, DOYLE MJ. Embriologia humana, Atheneu, São Paulo, MOORE K. Embriologia Clínica, Elsevier, Rio de Janeiro, BREW MCC. Histologia geral para a odontologia, Guanabara-Koogan, Rio de Janeiro, ATLAS DE HISTOLOGIA – UFRGS - ATLAS DE HISTOLOGIA – UERJ - ATLAS DE HISTOLOGIA CLARETIANO - ATLAS DE HISTOLOGIA UFPEL-http://minerva.ufpel.edu.br/~mgrheing/cd_histologia/index.htm ATLAS DE EMBRIOLOGIA HUMANA (Inglês) -http://www.embryo.chronolab.com/fertilization.htm MULTIDIMENSIONAL HUMAN EMBRYO (Inglês) - ATLAS OF HUMAN BIOLOGY – CRONOLAB (Inglês) -Http://www.embryo.chronolab.com/ fertilization.htm ATLAS DE HISTOLOGIA E EMBRIOLOGIA VIRTUAL UFSM.


Carregar ppt "CAPÍTULO 1 CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO Profa.Ivana BM Cruz, UFSM - 2011."

Apresentações semelhantes


Anúncios Google