A apresentação está carregando. Por favor, espere

A apresentação está carregando. Por favor, espere

CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO

Apresentações semelhantes


Apresentação em tema: "CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO"— Transcrição da apresentação:

1 CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO
Profa.Ivana BM Cruz, UFSM

2 Padrão de Organização dos Seres Vivos
Auto-criação (autopoiése) Reprodução Manutenção da constância do ambiente interno (homeostase) e do reparo

3 AUTO-CRIAÇÃO

4 REPRODUÇÃO

5 HOMEOSTASE

6 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS
Alimentos Carboidratos Produção de energia: glicose Armazenamento de energia: Glicose- Sangue Glicogênio – Músculos Fígado Fonte carboidratos (glicose): -Dieta Produzida pelo organismo Glicose UNIDADE

7 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS
Lipídios Principais moléculas Ácidos graxos Triglicerídeos Colesterol Participam: - Membrana Plasmática - A partir do colesterol são sintetizados todos os hormônios esteróides do corpo como o estrogênio, testosterona, vitamina D, etc. Moléculas mais heterogêneas

8 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS
Molécula fundamental na estrutura celular do ser vivo Proteínas Unidade fudamental: Aminoácidos Alimentos Cadeia de aminoácidos

9 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS
20 AMINOÁCIDOS AMINOÁCIDOS ESSENCIAIS: não sintetizamos arginina, fenilalanina, isoleucina, leucina, lisina, metionina, serina, treonina, triptofano, histidina e valina AMINOÁCIDOS NÃO-ESSENCIAIS alanina, asparagina, cisteína, glicina, glutamina, prolina, tirosina, ácido aspártico, ácido glutâmico Proteínas

10 MACRO-MOLÉCULAS FUNDAMENTAIS DOS SERES VIVOS
Ácidos Nucleícos: DNA & RNAs

11 ORGANIZAÇÃO DOS SERES VIVOS MULTICELULARES

12 NÍVEIS DE ORGNIZAÇÃO DOS SERES VIVOS

13 CÉLULAS E TECIDOS

14 Membrana Celular

15 Membrana Celular: funções
- Delimitação (isolamento físico) da célula em relação ao ambiente que a rodeia; Regulação das trocas químicas ou físicas entre o interior da célula e o ambiente externos; Comunicação entre as células e o seu meio ambiente; Suporte estrutural para que as células formem os tecidos corporais Delimitação de ambientes específicos intracelulares que possuem funções diferenciadas (organelas).

16 Membrana Celular Fonte: Silverthorn, 2002

17 Membrana Celular

18 Membrana celular: estrutura

19 Membrana celular: proteínas

20 Membrana celular: proteínas

21 Membrana celular: proteínas

22 Membrana celular: proteínas

23 Membrana celular: proteínas

24 Membrana celular: proteínas

25 Membrana celular: proteínas

26 Membrana celular: proteínas

27 Movimento através da membrana

28 Membrana: comunicação célula-célula
Existem dois tipos de sinais: químicos ou elétricos Existem três processos de comunicação: (1) transferência citoplasmática de sinais químicos/elétricos via junções comunicantes (2) comunicação local de substâncias que se difundem através do líquido extracelular (3) comunicação a longa distância: hormônios Fonte: Silverthorn, 2002

29 Membrana: comunicação célula-célula

30 Membrana: comunicação célula-célula

31 Membrana: comunicação célula-célula

32 Membrana: comunicação célula-célula

33 Membrana: comunicação célula-célula

34 CITOSOL E ORGANELAS

35 PRINCIPAIS FUNÇÕES DO CITOESQUELETO
CITOSOL E ORGANELAS PRINCIPAIS FUNÇÕES DO CITOESQUELETO Determina a forma das células Estabiliza a posição das organelas dentro do citoplasma Auxilia no transporte de moléculas para dentro e para fora da célula Auxilia na manutenção da célula em um local do tecido Permite o movimento de algumas células através do corpo

36 CITOSOL E ORGANELAS

37 CITOSOL E ORGANELAS

38 CITOSOL E ORGANELAS

39 CITOSOL E ORGANELAS

40 CITOSOL E ORGANELAS

41 CITOSOL E ORGANELAS

42 MATRIZ EXTRACELULAR Material sintetizado que e secretado pelas células
de um tecido Serve como sustentação do tecido e atua na manutenção da homeostase corporal A quantidade de matriz extracelular As moléculas que compõe a matriz extracelular Altamente variáveis e dependente do tipo de tecido

43 CICLO CELULAR

44 SENESCÊNCIA CELULAR 1 2 3 n LIMITE DE HAYFLICK + 50 DIVISÕES

45 CICLO CELULAR MITOSE G2 G1 n=50 S

46 ENVELHECIMENTO CELULAR
MITOSE G2 G1 n ~ 50 Modificações Estruturais e funcionais S Cessa a proliferação Célula cresce

47 Revisando… Proteção aos genes que estão nos cromossomos

48 simples molécula de DNA
Estrutura telomérica Telômero possui uma simples molécula de DNA (TTAGGG)n Resto do cromossomo é dupla fita Cromossomo

49 ENCURTAMENTO TELOMÉRICO

50 Processos Fundamentais da Diferenciação Celular

51 Divisão Celular Mitose Prófase Metáfase Anáfase Telófase

52 Interações Bioquímicas
Moléculas bioquímicas modulam: regulação diferencial dos genes: Genes funcionam conforme: - células e estágio do desenvolvimento

53 corporal e a manutenção da homeostase se todas as células
Núcleo Como ocorre o desenvolvimento corporal e a manutenção da homeostase se todas as células contém o mesmo DNA?

54 DOGMA GENE-PROTEÍNA/RNA
3’TAAGCAATCTCTGGTAAGCTA5’ 5’ATTCGTTAGAGACCATTGGAT3’ Núcleo DNA htRNA 5’ATTCGTTACCATTGGAT3’ Proteínas Célula Sliplicing mRNA

55 ESTRUTURA DO GENE EUCARIÓTICO

56 Modulação da Expressão
ESTRUTURA DO GENE EUCARIÓTICO Região Promotora Estradiol Modulação da Expressão do gene Testosterona Inibição/ Estimulação

57 Modulação da Expressão
REGULAÇÃO DA EXPRESSÃO GÊNICA Região Promotora Modulação da Expressão do gene Inibição/ Estimulação Resveratrol DIETA BENEFÍCIO A SAÚDE

58 Regulação Gênica Muitos processos biológicos ocorrem em todas
as células portanto a síntese de muitas proteínas é igual Algumas PROTEÍNAS são abundantes em tipos Especializados de células apesar dos seus Genes estarem em TODAS AS CÉLULAS

59 Regulação Gênica Estudos sugerem que uma célula eucariótica
Expressa aproximadamente mil genes dos 30 mil genes que possui.

60 Modificações pós-síntese
Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

61 Modificações pós-síntese
Regulação Gênica A expressão de um gene é CONTROLADA DNA Rna heterogêneo mRNA Proteína Modificações pós-síntese Controle transcricional Controle splicing (processamento) Controle traducional Controle pós-síntese

62 Movimento Celular Para a formação dos tecidos e órgãos
Muitas células precisam se mover dentro do embrião Este processo denomina-se: Movimento Celular ou Migração Celular Movimento celular é gerado por elementos contráteis do citoesqueleto Principais proteínas associadas ao movimento celular: integrinas e fibronectinas

63 Direção da migração Integrinas Filopódia Contato focal
Parece que a migração celular é mediada por proteínas que são agrupadas “Família Abelson de tirosina quinases- Abn Family”.

64 Adesão Celular Processo pelo qual as células ficam aderidas em um determinado local do corpo. Mediado por moléculas conhecidas como: CAM= moléculas células-adesivas (Cell Adhesive Molecules) Ex. Caderinas

65 Adesão Celular Caderinas conectam uma célula na outra
Auxiliando na adesão a matriz extracelular

66 Morte Celular Programada- Apotose
Suícidio de determinadas linhagens celulares ao longo da embriogênese, ou de algumas células ao longo da vida

67 Morte Celular Programada- Apotose
Exemplo: formação dos dedos

68 BIOLOGIA CELULAR E O CÂNCER

69 ESCAPE DA SENESCÊNCIA REPLICATIVA
CELULAR: CÂNCER Causado pelo crescimento descontrolado de células que também têm a capacidade de invadir outros tecidos e formar tumores secundários (metástases)

70 O CÂNCER É UMA DOENÇA GENÉTICA CAUSADO POR ACÚMULO DE
MUTAÇÕES Ocorrem mutações no DNA Ativam genes que estavam silenciados Proto-oncogenes Inativam genes que estavam ativos Genes de supressão tumoral

71 Célula normal 1a Mutação 2a Mutação 3a Mutação Célula Maligna (Câncer)

72 PRINCIPAIS ALTERAÇÕES MORFO-FUNCIONAIS
DA CÉLULA CANCEROSA

73 (1) DIVISÃO CELULAR Escape da senescência NEOPLASIA celular
MITOSE G1 G2 S Número Indefinido de Mitoses IMORTALIZAÇÃO

74 PRINCIPAL CAUSA DA IMORTALIZAÇÃO
RE-ATIVAÇÃO DA ENZIMA TELOMERASE OS TELÔMEROS DA CÉLULA VOLTAM A SER PRODUZIDOS CÉLULA SE REPLICA INDEFINIDAMENTE

75 Linhagem celular Imortal de Henrietta Lacks CÉLULAS HeLA Imortalização
Mulher jovem com câncer cervical (Adenocarcinoma) Morreu em 1951 Células continuam a ser produzidas e utilizadas por laboratórios no mundo todo CÉLULAS HeLA Utilizadas para estudos in vitro sobre o câncer

76 (2) ALTERAÇÕES NAS INTERAÇÕES BIOQUÍMICAS
Citoesqueleto desorganizado: perda da forma celular original Menor quantidade de organelas Menor tamanho celular Núcleo fica proporcionalmente maior em relação a célula Perda da função celular

77 (2) Exemplo: câncer de colo do útero
Cervix saudável Esfregaço celular (Exame Papanicolau) Cervix com carcinoma Célula saudável

78 (3) MOVIMENTO E ADESÃO CELULAR

79 (3) MOVIMENTO E ADESÃO CELULAR
Consequência principal: METÁSTASES

80 (3) MOVIMENTO E ADESÃO CELULAR

81 (4) APOPTOSE Câncer – resistência a apoptose
células não desencadeiam a sua morte Esta alteração está relacionada: - com o inicio da carcinogênese - com resistência de células cancerosas a quimioterapia e a radioterapia Mecanismos de resistência: - inibição de proteínas pró-apoptóticas Ex. p53 - expressão de proteínas pró-oncogênicas Ex. survivinas

82 CONSIDERAÇÕES FINAIS O padrão de auto-organização dos seres vivos,
em especial dos organismos multicelulares, Envolve padrões cito-morfológicos e fisiológicos Que garantem o seu desenvolvimento, processos de regeneração/cicatrização, controle homeostático e reprodução. Para tanto existem 05 processos fundamentais

83 REFERÊNCIAS – BIBLIOGRÁFICAS E DE FIGURAS
JUNQUEIRA LC & CARNEIRO J. Histologia Básica. Guanabara-Koogan, Rio de Janeiro, 2004; 2008 KERR JB. Atlas de Histologia Funcional. Artes Médicas, Porto Alegre, 2000. GARTNER Color Atlas Histology. Williams & Wilkins, Baltimore, 1994. KIERSZENBAUM AL. Histologia e biologia celular: uma introdução a patologia. Elsevier, Rio de Janeiro COCHARD LR. Atlas de embriologia humana de Netter. Artmed, Porto Alegre, 2001. DOYLE MJ. Embriologia humana, Atheneu, São Paulo, 2005. MOORE K. Embriologia Clínica, Elsevier, Rio de Janeiro, 2008. BREW MCC. Histologia geral para a odontologia, Guanabara-Koogan, Rio de Janeiro, 2003. ATLAS DE HISTOLOGIA – UFRGS - ATLAS DE HISTOLOGIA – UERJ - ATLAS DE HISTOLOGIA CLARETIANO - ATLAS DE HISTOLOGIA UFPEL-http://minerva.ufpel.edu.br/~mgrheing/cd_histologia/index.htm ATLAS DE EMBRIOLOGIA HUMANA (Inglês) -http://www.embryo.chronolab.com/fertilization.htm MULTIDIMENSIONAL HUMAN EMBRYO (Inglês) - ATLAS OF HUMAN BIOLOGY – CRONOLAB (Inglês) -Http://www.embryo.chronolab.com/ fertilization.htm ATLAS DE HISTOLOGIA E EMBRIOLOGIA VIRTUAL UFSM.


Carregar ppt "CAPÍTULO 1 FUNDAMENTOS DE BIOLOGIA CELULAR E DO DESENVOLVIMENTO"

Apresentações semelhantes


Anúncios Google