Introdução à análise por marcadores moleculares Prof. Vinicius Campos Disciplina de Biotecnologia Animal Graduação em Biotecnologia UFPel

Genética 1900s - Descoberta dos princípios genéticos 1920-50 - Melhoramento genético científico genética quantitativa e biometria (fenótipo é previsor ruim do valor genético!) 1970-80 - Utilização de marcadores genéticos molecularesA

Sucesso no melhoramento depende da capacidade de distinguir fatores genéticos herdáveis dos ambientais Marcadores genéticos são unidades herdáveis simples marcadores cromossoma

Polimorfismo de DNA resulta acúmulo de mutações pontual ou inserção/deleção macro-rearranjos: translocações, inversões, deleções

Origem do Polimorfismo Molecular Mutações pontuais – SNPs A. ATCTCGTGATTCCTAGTCGTA TAGAGCACTAAGGGATCAGCAT ex. Sítio EcoRI B. ATCTCGTGATTATAGTCGTA TAGAGCACTAATATCAGCAT 2. Pequenas deleções e/ou inserções - InDels A. ATCTCGTCTAGTCGTA TAGAGCAGATCAGCAT B. ATCTCGT---GTCGTA TAGAGCA---CAGCAT

Classes de Marcadores Principais Marcadores na Indústria Animal Polimorfismos Tipo RFPL Polimorfismos Tipo RAPD Marcadores Microssatélites

Restriction Fragment Length Polymorphism - RFLP Polimorfismo de tamanho de fragmento RFLP examina diferença em tamanho de fragmentos de restrição de DNA específicos Polimorfismo deriva de mutação pontual, inserção, deleção Utiliza-se DNA celular total Requer DNA puro de alto peso molecular

Como funciona

Herança

RFLP - Procedimento Extração de DNA A amostra de DNA é amplificada por PCR Digestão enzimática dos produtos de PCR com enzima de restrição adequada e à sua temperatura ótima Utilizam-se controles normais e se disponíveis controlos homozigóticos e heterozigóticos para a mutação Os produtos da digestão são colocados nos poços de um gel de agarose ou de poliacrilamida

RFLP - Análise

RFLP Eletroforese da digestão enzimática com MscI e FauI para pesquisa da mutação L858R

RFLP Eletroforese da digestão enzimática com Bcl I para pesquisa da mutação H63D

Random Amplification of Polymorphic DNA - RAPD Amplifica seqüências anônimas de DNA usando primers arbitrários 10 bases com >50% G+C PCR com um único primer Método rápido para detecção de polimorfismos Marcador dominante Problemas de reproducibilidade The random amplified polymorphic DNA (RAPD) technique is a PCR based method which uses one or sometimes two short arbitrary primers (usually 8-10 bases) to amplify anonymous stretches of DNA which are then separated and visualised by gel electrophoresis. The key point about this technique is that nothing is known about the identity of the amplification products. The amplification products are however extremely useful as markers in genetic diversity studies. Other important features of the technique are: The number of fragments. Many different fragments are normally amplified using each single primer, and the technique has therefore proved a fast method for detecting polymorphisms. The majority of commercially produced primers result in 6 to 12 fragments; some primers may fail to give any amplification fragments from some material. Simplicity of the technique. RAPD analysis does not involve hybridisation/autoradiography or high technical expertise. Only tiny quantities of target DNA are required. Arbitrary primers can be purchased. Unit costs per assay are low. This has made RAPD analysis very popular. RAPD markers are dominant. Amplification either occurs at a locus or it does not, leading to scores of band presence/absence; this means that homozygotes and heterozygotes cannot be distinguished. Problems of reproducibility - RAPD does suffer from a sensitivity to changes in PCR conditions resulting in changes to some of the amplified fragments. Reproducible results can be obtained if care is taken to standardise the conditions used (Munthali et al., 1992; Lowe et al., 1996).

RAPD AA AA Aa aa Aa The random amplified polymorphic DNA (RAPD) technique is a PCR based method which uses one or sometimes two short arbitrary primers (usually 8-10 bases) to amplify anonymous stretches of DNA which are then separated and visualised by gel electrophoresis. The key point about this technique is that nothing is known about the identity of the amplification products. The amplification products are however extremely useful as markers in genetic diversity studies. Other important features of the technique are: The number of fragments. Many different fragments are normally amplified using each single primer, and the technique has therefore proved a fast method for detecting polymorphisms. The majority of commercially produced primers result in 6 to 12 fragments; some primers may fail to give any amplification fragments from some material. Simplicity of the technique. RAPD analysis does not involve hybridisation/autoradiography or high technical expertise. Only tiny quantities of target DNA are required. Arbitrary primers can be purchased. Unit costs per assay are low. This has made RAPD analysis very popular. RAPD markers are dominant. Amplification either occurs at a locus or it does not, leading to scores of band presence/absence; this means that homozygotes and heterozygotes cannot be distinguished. Problems of reproducibility - RAPD does suffer from a sensitivity to changes in PCR conditions resulting in changes to some of the amplified fragments. Reproducible results can be obtained if care is taken to standardise the conditions used (Munthali et al., 1992; Lowe et al., 1996). aa

Interpretação de RAPDs Marcadores RAPD são anônimos Dados binários (presença x ausência) RAPD são dominantes (AA = Aa) Problemas de co-migração mesma banda, mesmo fragmento? uma banda, um fragmento? Questionamento para filogenia banda homólogas?

PCR com primers arbitrários: acúmulo de siglas! RAPD Random Amplified Polymorphic DNA DAF DNA Amplification Fingerprinting AP-PCR Arbitrarily Primed Polymerase Chain Reaction MAAP Multiple Arbitrary Amplicon Profiling (sugerido por incluir todas as pequenas variações na técnica) All of the following techniques use one or two, short, GC-rich primers of arbitrary sequence. RAPD was the first to become available (Williams et al., 1990) and is by far the most commonly used of these techniques. DAF - DNA amplication fingerprinting Differences between DAF (Caetano-Anolles, et al., 1991a,b) and RAPD: higher primer concentrations in DAF shorter primers used in DAF (5-8 nucleotides) two-temperature cycle in DAF compared to 3-temperature cycle in RAPD DAF usually produces very complex banding patterns AP-PCR - arbitrarily primed polymerase chain reaction Differences between AP-PCR (Welsh and McClelland, 1990) and RAPD: in AP-PCR the amplification is in three parts each with its own stringency and concentrations of constituents high primer concentrations are used in the first PCR cycles primers of variable length, and often designed for other purposes are arbitrarily chosen for use (e.g. M13 universal sequencing primer) MAAP is only an acronym proposed by Caetano-Anolles et al. (1992) to encompass all of these closely related techniques, but which is not commonly used.

Diferenças entre ensaios com primers arbitrários RAPD 10mers, gel de agarose corado com brometo DAF 5mers, gel de acrilamida e reação marcada 32P AP-PCR 10mers, gel de acrilamida e reação marcada 32P All of the following techniques use one or two, short, GC-rich primers of arbitrary sequence. RAPD was the first to become available (Williams et al., 1990) and is by far the most commonly used of these techniques. DAF - DNA amplication fingerprinting Differences between DAF (Caetano-Anolles, et al., 1991a,b) and RAPD: higher primer concentrations in DAF shorter primers used in DAF (5-8 nucleotides) two-temperature cycle in DAF compared to 3-temperature cycle in RAPD DAF usually produces very complex banding patterns AP-PCR - arbitrarily primed polymerase chain reaction Differences between AP-PCR (Welsh and McClelland, 1990) and RAPD: in AP-PCR the amplification is in three parts each with its own stringency and concentrations of constituents high primer concentrations are used in the first PCR cycles primers of variable length, and often designed for other purposes are arbitrarily chosen for use (e.g. M13 universal sequencing primer) MAAP is only an acronym proposed by Caetano-Anolles et al. (1992) to encompass all of these closely related techniques, but which is not commonly used.

GEL RAPD

RAPD - resumo Rápido Simples Baixo custo Sem uso de radio-isótopos Marcador dominante Problemas de reproducibilidade Problemas de interpretação

Microssatélites Sequence-Tagged Microsatélites (STMS) também conhecido como microssatélite ou Simple Sequence Repeat (SSR) Normalmente locus simples e multi-alélico Co-dominante Altamente reprodutível

Microssatélites Seqüências curtas (1 a 6 bases) repetidas em tandem Presentes em procariotos e eucariotos Presentes em regiões codificantes e não codificantes Maioria das repetições são dinucleotídeos (AC) n (AG) n (AT)n

Microssatélites Normalmente locos simples e multi-alélico Polimorfismo devido a diferenças no número de repetições Escorregamento da DNA polimerase durante a replicação Crossing-over desigual entre cromátides irmãs Codominantes Normalmente locos simples e multi-alélico

Microssatélites altamente informativo - vários alelos por locos detecção por PCR facilmente transferível entre labs distribuição homogênea no genoma

Microssatélites Repetição CA Primer FOR Primer REV NNNNNNNNNNNNNNNNNNNNN CACACACACACACACACAC NNNNNNNNN NNNNN NNNNNNNNNNNNNNNNNNNNN GTGTGTGTGTGTGTGTGTG NNNNNNNNNNNNNN Repetição CA Primer REV

Obtenção de seqüências: Microssatélites Obtenção de seqüências: a partir de banco de dados de genoma ou cDNA hibridação com biblioteca genômica, identificação de clones e seqüenciamento construção de biblioteca enriquecida por afinidade com seqüência da matriz

Microssatélites Detecção do polimorfismo Géis de agarose Géis de acrilamida (detecta diferenças de até 2pb) coloração direta: nitrato de prata (barato) Coloração indireta: marcação radioativa ou fluorescente

Análise Microssatélites

Microssatélites Problemas Custo e trabalho envolvidos no desenvolvimento dos primers Construção de bibliotecas genômica sequenciamento Triagem dos melhores primers Possibilidade de se usar seqüências depositadas em banco de dados EST (Expressed Sequence Tags) - SSR funcional x SSR genômico

Comparação entre Marcadores RFLP RAPD SSR Polimorfismo Pontual ou InDel Nº de Rep. Nível do Polimorfismo Médio Alto Abundância Alta Média MédiaAlta Dominância Co-Dominante Dominante [DNA] 10 ug 25 ng 50 ng Marcação Sim/Não Não Repetibilidade Baixa